Primers for PUMA were forward, CGGAGCAGCACCTGGAGTCG; and reverse, TTGAGGTCGTCCGCCATCCG. downstream target PUMA is increased, leading to activation of the intrinsic apoptotic pathway. Collectively, our results suggest that WTIP is a tumor suppressor and a potential target for therapeutic intervention in AML. gene regulation remain elusive. The 19q13.11 microdeletion syndrome is NBTGR a clinically recognizable condition characterized by growth deficiency, microcephaly, ectodermal anomalies, and intellectual disability, suggesting missing of potentially key genes in this region [14C17]. The is a candidate gene that maps to chromosome 19q13.11 [15, 17]. As a member of mammalian P-body associated protein, WTIP is involved in miRNA-mediated gene silencing in human osteosarcoma cells [18]. In cervical cancer cells, downregulation of WTIP abolished BRCA2-mediated centrosome localization and resulted in abnormal cell division, suggesting that WTIP might be involved in the development of cervical cancer [19]. Recently, it was demonstrated that WTIP protein expression is significantly reduced in non-small-cell lung cancer (NSCLC) cells, and WTIP downregulation is associated with poor prognosis in NSCLC patients [20]. In our previous study, we identified a novel fusion gene named in AML and found that it abrogates WTIP-mediated P-body formation [21]. While overexpression of UBA2-WTIP promotes cell proliferation, overexpression of WTIP suppresses cell proliferation in human leukemic KG1a cells [21]. These findings support the notion that WTIP is a candidate tumor suppressor. However, the molecular mechanisms of WTIP in leukemogenesis have not been explored. In this study, we revealed that WTIP expression is downregulated and significantly associated with NBTGR poor prognosis in AML patients. Overexpression of WTIP inhibited cell proliferation and colony formation in AML cells. We further showed that WTIP overexpression was effective to induce apoptosis by upregulating FOXO3a and promoting its nuclear localization. Furthermore, we found that WTIP interacts with FOXO3a and transcriptionally activates FOXO3a mRNA expression. Upon transcriptional activation of FOXO3a, its downstream target p53 upregulated modulator of apoptosis (PUMA) is increased, leading to activation of the intrinsic apoptotic pathway. These results suggest that WTIP is a tumor suppressor and a potential target for therapeutic intervention in AML. Materials and methods Clinical samples and cell lines Bone marrow samples were obtained from primary AML patients and healthy donors with informed consent in accordance with the Declaration of Helsinki. Studies were approved by the ethics committee NBTGR of Zhejiang Provincial Peoples Hospital, Peoples Hospital of Hangzhou Medical College. KG1a, Kasumi-1, HL-60, MOLM-13, THP-1, U937 cells (human AML cell lines), HEK293 and HEK293T (human embryonic kidney cell line) were obtained from American Type Culture Collection (ATCC, Manassas, VA). KG1a, Kasumi-1, HL-60, THP-1, and U937 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS, GIBCO, Bethesda, MD, USA). MOLM-13 cells were cultured in an NBTGR IMDM medium Rabbit polyclonal to ZNF561 with 10% FBS. HEK293 and HEK293T cells were cultured in a DMEM medium with 10% FBS. Western blot analysis Western blot analysis was performed as previously described [22]. Antibodies used in this study are as follows: anti-PARP1 (#9532), anti-Caspase-3 (#9662), anti-Cleaved Caspase-3 (#9661), anti-Caspase-9 (#9502), anti-Cleaved Caspase-9 (#9505), anti-p53 (#9282) antibodies obtained from Cell Signaling Technology (Beverly, MA, USA), anti-Bcl-2 (ab32124), anti-Bax (ab32503), and anti-Phospho-FOXO3a(Thr32) (#9464) antibodies obtained from Abcam (Abcam, Cambridge, UK), anti-PUMA antibody (ER31215) obtained NBTGR from HuaBio (Hangzhou, China), anti-WTIP antibody (PA5-48292) obtained from Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, USA), anti-FLAG antibody purchased from Sigma-Aldrich (St. Louis, MO, USA), anti-FOXO3a (#2497) and anti-GAPDH antibody (60004-1-Ig) obtained from Proteintech (Proteintech Group, Chicago, IL, USA). Apoptosis.